| Nutritional and genetic adaptation of galliform birds: implications for hand-rearing and restocking | ||
|---|---|---|
| Prev | Chapter 3. Material and methods | Next |
Maternally inherited, haploid mitochondrial DNA (mtDNA) control region 1 (CR 1) was used to study the genetic background of grey partridge populations in Europe (VI). Fresh or museum samples (feathers, tissue, blood, eggs) were collected from several locations. Finnish wild populations were sampled from four separate areas: eastern Uusimaa, southern Häme, South and North Ostrobothnia (Oulu region). Finnish hand-reared birds were sampled from two different private farmstocks; Lars Ahlström (the Jokiniemi Mansion, Ruotsinpyhtää), and Veijo Mikkilä (Lapua). Samples from wild populations were received from Austria, Bulgaria, England, Estonia, France, Germany, Greece, Ireland, Italy, Kazakhstan (Fig. 3), Poland, Russia and Sweden. Gamefarm samples were received from Hungary, Italy, and Sweden, and museum samples from Estonia and Latvia.
Total DNA was extracted using separate methods for feathers (modified Chelex-method, Walsh et al. 1991), blood and other tissues (standard phenol-chloroform method, Sambrook et al. 1989, and PureGene procedure). MtDNA was extracted from the embryonic plates in eggs using the method of Tamura and Aotsuka (1988), modified by Kvist et al. (1998). Even though hardened feather quills seem relatively poor source of DNA, they are less problematic than blood with respect to nuclear contamination (Sorenson & Quinn 1998).
DNA-extraction was followed by the PCR. Amplified PCR product was purified from 1 % agarose gel using polyester plug spin inserts (Glenn & Glenn 1994). Sequencing was carried out using the automatic ABI377 DNA sequencer.
The primers for whole CR were designed based on the conserved regions located in the tRNAGlu and tRNAPhe genes of the chicken Gallus gallus (Desjardins & Morais 1990) and the quail Coturnix coturnix (Desjardins & Morais 1991) available in GeneBank. After sequencing of CR, more specific primers were designed. The forward primer for the first 410 nucleotides of the control region 1 (downstream from tRNAGlu) was LPPGLU (5’CACTGTTGTTCTCAACTACAGG) and the reverse primer was H414 (5’GGTGTAGGGGGAAAGAATGGG).