| Effects of apolipoprotein and low density lipoprotein receptor gene polymorphisms on lipid metabolism, and the lipid risk factors of coronary artery disease | ||
|---|---|---|
| Prev | Chapter 4. Methods | Next |
The lipid and lipoprotein samples were drawn after a 12-hour fast. The values were determined from EDTA blood, from which plasma and cells were separated by routine centrifugation at 2000 rpm for ten minutes. The plasma lipoprotein fractions were isolated by ultracentrifugation in a Beckman 60 Ti rotor (Beckman Instruments, Palo Alto, CA) as described by Havel et al. (Havel et al. 11955). VLDL was isolated at a density of 1.006 g/ml. The cholesterol value was determined enzymatically by using the Boehringer Mannheim CHOD-PAP method and the triglycerides by using the Boehringer Mannheim GPO-PAP method and a Gilford analyser (Gilford Instruments Laboratories Inc., Oberlin, Ohio), and HDL cholesterol was determined from the VLDL-free fraction after precipitating IDL and LDL with heparin-manganese. The protein concentrations of the fractions were measured by the method of Lowry et al. (Lowry et al. 1951). The amount of apolipoprotein B was determined after isopropanol precipitation (Holmquist & Carlson 1977). In the RS-86505-007 study, the LDL cholesterol was determined from the formula of Friedewald et al. (Friedewald 1972).
The plasma lipid and lipoprotein analyses were carried out on blood samples collected into EDTA tubes after a 12-hour fast. The plasma lipoprotein fractions were isolated by ultracentrifugation in a Beckman 60 Ti rotor (Beckman Instruments, Palo Alto, CA) as described by Havel et al. (Havel et al. 1955), VLDL at a density of 1.006 g/ml, IDL at 1.006-1.019 g/ml and LDL at 1.019-1.063 g/ml, using a fixed angle TFT rotor at 108000 x g for 18 hours at +15C, and HDL at a density of 1.210 for 48 hours. A separate plasma sample was drawn simultaneously, from which VLDL was isolated as described above and HDL cholesterol was determined after precipitation of apolipoprotein B containing lipoproteins with heparin-manganese. LDL cholesterol (including the IDL fraction) was calculated by subtracting the HDL cholesterol value from the VLDL infranatant cholesterol value. These lipid values were used in the lipid comparisons, and also to compensate for the losses of material in serial ultracentrifugations while calculating the apolipoprotein B concentration for LDL production. The lipoprotein particle compositions were calculated using the lipid and protein concentrations obtained from the serial ultracentrifugations.
LDL for the turnover studies was isolated from 80 ml of plasma with sequential ultracentrifugations. First, the plasma was adjusted to a density of 1.019 g/ml and centrifuged at 59000 x g and +15C for 18 h. The infranatant was then adjusted to a density of 1.063 and centrifuged as above. The supernatant was recentrifuged after adjustment with NaCl-NaBr solution (1:1) to a density of 1.070 at 35000 x g and +15C for 18h. The protein concentration was determined from 100 ml of LDL, and the rest was dialysed against 0.9% saline, pH 7.4, for 1.5 hours with three changes of dialysate.
Radiolabeling of LDL was carried out using a modification (Bilheimer et al. 1972) of the iodine monochloride method of McFarlane (McFarlane 1958). The excess iodine was removed by column chromatography (PD-10 Sephadex G-25M, Pharmacia, Uppsala, Sweden) and EDTA saline dialysis. Precipitation with 10% trichloroacetic acid showed that 94.0 (2.2) % (mean and SD) of the 125I counts and 96.2 (2.4)% of the 131I counts were bound to protein. The lipid labelling was 10.3 (3.7)% for 125I and 12.2 (5.4)% for 131I, as determined with a chloroform-methanol solvent (2:1) by using the method of Folch et al. (Folch et al. 1957).
After labelling, LDL was sterilised by filtration through a 0.45 mm filter. In half of the turnover studies, autologous LDL was labelled with 125I and homologous LDL with 131I, and vice versa.
The fractional catabolic rates, determined as the intravascular pool of LDL catabolised per day, for autologous and homologous LDL were calculated from the plasma decay curves using the Matthews method (Matthews 1957) adapted for LDL turnover studies (Langer et al. 1972). In the model, two exponential equations are fitted to each plasma decay curve using an interactive curve-peeling program (W.F. Beltz & T.E. Carew, unpublished method) on a VAX-VMS Computer. The LDL apo B production rates were calculated from the autologous FCR, pool volume and LDL apo B concentration and expressed as milligrams per kilogram of body weight per day.
The lipoprotein(a) concentration was measured by using the Pharmacia Apolipoprotein(a) RIA 100 assay system. The assay is a solid-phase, two-site immunoradiometric assay that uses two monoclonal antibodies directed towards different epitopes of apolipoprotein(a). The standard curve range was 16.8–840 U apolipoprotein(a)/l. The apo(a) values were multiplied by 0.7 and divided by ten to get the Lp(a) concentrations in mg/dl.
The apo E phenotypes were determined from plasma after delipidation using isoelectric focusing and immunoblotting techniques (Menzel & Uterman 1986).
The apolipoprotein A1 concentration was determined nephelometrically by measuring the turbidity of the apo A1 antigen-antibody complex with the Turbox method (Orion Diagnostica).
CETP activity was determined as described by Savolainen et al. (Savolainen et al. 1990), using the method of Groener (Groener et al. 1986), where VLDL+LDL-free plasma is incubated with radioactively labelled LDL and unlabelled HDL. CETP activity is expressed as nmol of cholesteryl esters transferred from LDL to HDL per hour per ml of plasma.
The apo B polymorphisms were detected by using the polymerase chain reaction (PCR). Blood samples for the apo B polymorphisms were collected into EDTA tubes and stored at -20C until analysed. DNA was prepared by the salting-out method described by Miller et al. (Miller et al. 1988). A primer pair (5´ primer, nucleotides 7336Æ7359, 5"ACCAAGGCCACAGTTGCAGTGTAT3"; 3" primer, nucleotides 7665Æ7642, 5"CTCTACCAATGCTTTCATACGTTTAG3") was used to amplify a 330 base-pair product containing the XbaI polymorphism site (Thr2488) of the apo B gene (Priestley et al. 1985, Blackhart et al. 1986), and another pair of primers (5" primer, nucleotides 12295Æ12318, 5"ATCGACGTGAGGTTCCAGAAAGCA3"; 3" primer, nucleotides 12684Æ12661, 5"GAAAGGAAGTGTAATCACTAGGTCTT3") was used to amplify a 390 base-pair product containing the EcoRI polymorphism site (Glu4154ÆLys) at the apo B gene as described by Ukkola et al (Ukkola et al. 1993b). This method with a 5" primer, nucleotides 10587Æ10602 5"ACCTCTTACTTTTCCATTGAGTCATC3"; and a 3" primer, nucleotides 11178Æ11154 5"ATC CCATAAGCTCTTGTCATAGACT3" was also used to amplify a 592 base-pair product containing the MspI polymorphism site Arg3611ÆGln in the apo B gene. The ins/del polymorphism was detected as described by Boerwinkle (Boerwinkle et al. 1991b), except for the gel electrophoresis, which was done on 2% Agar+6% NuSieve gel.
The apo B-3531 ArgÆCys mutation was detected using the NsiI restriction site polymorphism described by Pullinger et al. (Pullinger et al. 1995) and the MspI oligonucleotides described above. The apo B 3500 G to A mutation was detected using the method described by Tybjaerg-Hansen et al. (Tybjaerg-Hansen et al. 1990), with the exception of the allele-specific oligonucleotides used to detect the presence of the G to A mutation at position 10699, which were two basepairs longer than those used by Tybjaerg-Hansen (5"AGCACACGGTCTTCA3" for the normal allele and 5" AGCACACAGTCTTCA3" for the mutant allele). The filters were exposed to x-ray films (Kodak X-Omat AR) for 24 hours at -70C.
DNA amplification was carried out in a final volume of 50 ml using 0.25 mg of genomic DNA and 20 nmol of each of the primers. The 4 deoxynucleotides (dATP, dCTP, dGTP, dTTP) were present at a final concentration of 200 mmol/l. The reaction buffer was that recommended by the manufacturer. The amplification reaction was started by the addition of 0.5 units of Taq polymerase (Dynazyme, Finnzymes OY, Espoo, Finland). Annealing, extension and denaturing were carried out at 3 temperatures using an automatic thermal cycler (Perkin-Elmer Cetus, CT, USA). After the first cycle of 5 min at 95C, 1 min at 60C and 2 min at 72C, thirty-nine cycles of 1 min at 95C, 1 min at 60C and 1 min at 72C were carried out for each reaction. The PCR products were digested at 37C for 1 h using 25 ml of each PCR amplified product with 10 units of the restriction enzyme (New England Biolabs, Inc., Beverly, MA, USA). The digestion products were electrophoreses at 75 V for 1.5 h through a 1.5 percent agarose gel stained with ethidium bromide and visualised by ultraviolet light.
Oligonucleotides were synthesised with the methoxyphosphoamidite method on an Applied Biosystems 380A DNA synthesiser. The oligonucleotides were deprotected by treatment in 25% (w/v) ammonia, recovered by precipitation with ethanol, and finally dissolved in 10 mM TRIS-HCl, 1mM EDTA, pH 7.5, at a concentration of 20 mmol/ml and stored at -20C until used. The first two oligonucleotide primers, LR05 5’d(CAGCTCCACAGCCGTAAGGACACAGC) and LR06 5’d(ACTCTGAACTGAGAAAGTGCAAGGAG), span the positions 2193 to 2218 within exon 15 of the coding strand of the LDL receptor gene and the positions 3391 to 3416 within exon 18 of the non-coding strand, respectively. In the presence of the FH-Helsinki mutation in the LDL receptor gene, the PCR technique yields a product 391 base pairs in length, whereas in the absence of the mutation, the product would be over 9000 bp long and thus beyond the scope of the amplification reaction. The other two primers, AE03 5’d(AGACGCGGGCACGGCTGTCCAAGGA) and AE04 5’d(CCTCGCGGGCCCCGGCCTGGTACACT), correspond to sequences of the apolipoprotein E gene and serve to control the adequacy of the PCR amplification. The PCR product of the apo E gene is 244 bp in length. Another pair of oligonucleotides was designed to detect the FH-North Karelia mutation. The 5’ primer was a sequence of intron 5 and exon 6 (5’CTCTGGCTCTCACAGTGACACTCT3’). The 3’ primer (5’ATTCGTACTCACCGCACTCTTTTCA3’) was designed to match the mutated gene, so that the last three (or four) nucleotides of the 3’ end of the primer were located immediately after the deletion site.
Target sequences were amplified in 100ml of reaction mixture containing 0.5-1.0mg genomic DNA, 20 nmol of each deoxyribonucleotide, 10 mmol/l TRIS-HCl, pH 8.3, 0.01% (w/v) gelatine, 50 mmol/l KCl, 1.5 mmol/l MgCl2, 100 pmol of each amplification primer, and 2.5 units of Taq polymerase (Ampli-Taq, Perkin Elmer cetus, Norwalk, CT, USA). The first cycle comprised a denaturing step at 94C for 5 min, annealing at 60C for 5 min and primer extension at 70C for 2 min in a programmable thermal cycler (Perkin Elmer Cetus). The subsequent 39 cycles consisted of 1 min denaturation at 94C, 30 s annealing at 60C, and 30 s elongation at 70C. The primer extension of the 40th cycle was extended to 10 min.
The PCR product (18 ml) was fractionated by gel electrophoresis in 1.5%(w/v) agarose gel in 40 mM TRIS-acetate, pH 7.8, 1 mM EDTA, until the bromophenol blue marker dye reached the 5 cm level. A 123 bp DNA ladder (GIBCO/BRL, Grand Island, NY) was used as a standard to provide estimates of molecular size. The DNA-ethidium-bromide complex was visualised by ultraviolet fluorescence and photographed to give a permanent record.
Coronary angiography was performed using the Judkins method and analysed according to the clinical routine of the hospital. A luminal narrowing of 50% or more was defined as a significant lesion, and the patients have been referred to as the severe CAD group. Patients with lesions with less than 50% luminal narrowing were considered not to have significant coronary artery disease and they have been referred to as the moderate CAD group. Three-vessel disease involved significant lesions in all the three vessels; the left main or the left anterior descending artery with its diagonal branches, the left circumflex artery with its marginal branches, and the right coronary artery. If two of the major branches or the left main coronary artery were involved, the patient was defined as having two-vessel disease, and if only one of the branches was involved, the patient was defined as having one-vessel disease.
The haematologic tests were done in the local hospital laboratories. Urine was checked semi-quantitatively for sugar and protein. The values for liver function (SGOT, SGPT, GGTP and alkaline phosphatase), thyroid function (total T4, free thyroxin, thyroid stimulating hormone), plasma total proteins, serum glucose, fructosamine, uric acid, urea, creatinine, albumin, haptoglobin, iron, total iron binding capacity, transferrin, lactate dehydrogenase, phosphorous, calcium, potassium and bilirubin were determined at the Calab laboratories in Stockholm, Sweden. Blood pressure was measured manually by one of the two nurses after at least 15 minutes’ rest in a sitting position.